Skip to main content
  • Research article
  • Open access
  • Published:

C. elegans serine-threonine kinase KIN-29 modulates TGFβ signaling and regulates body size formation

Background

In C. elegans there are two well-defined TGFβ-like signaling pathways. The Sma/Mab pathway affects body size morphogenesis, male tail development and spicule formation while the Daf pathway regulates entry into and exit out of the dauer state. To identify additional factors that modulate TGFβ signaling in the Sma/Mab pathway, we have undertaken a genetic screen for small animals and have identified kin-29.

Results

kin-29 encodes a protein with a cytoplasmic serine-threonine kinase and a novel C-terminal domain. The kinase domain is a distantly related member of the EMK (ELKL motif kinase) family, which interacts with microtubules. We show that the serine-threonine kinase domain has in vitro activity. kin-29 mutations result in small animals, but do not affect male tail morphology as do several of the Sma/Mab signal transducers. Adult worms are smaller than the wild-type, but also develop more slowly. Rescue by kin-29 is achieved by expression in neurons or in the hypodermis. Interaction with the dauer pathway is observed in double mutant combinations, which have been seen with Sma/Mab pathway mutants. We show that kin-29 is epistatic to the ligand dbl-1, and lies upstream of the Sma/Mab pathway target gene, lon-1.

Conclusion

kin-29 is a new modulator of the Sma/Mab pathway. It functions in neurons and in the hypodermis to regulate body size, but does not affect all TGFβ outputs, such as tail morphogenesis.

Background

The transforming growth factor β (TGFβ) superfamily is involved in many developmental decisions from primitive animals such as Cnidaria and sponges to higher animals [14]. The core of the signaling pathway has been elucidated in the last few years and reveals a rather simple signaling cascade. These ligands transmit the TGFβ signal by binding transmembrane receptor serine-threonine kinases (RSKs). Once ligand is bound, the type II RSK phosphorylates the type I RSK in a cytoplasmic region rich in glycine and serine residues (GS domain). Phosphorylation activates the type I RSK and enables it to phosphorylate downstream mediators referred to as the Smads. Once the receptor-regulated Smads (R-Smads) are phosphorylated, they are able to physically interact with another subset of Smads identified as the common Smads (Co-Smads) and translocate to the nucleus where they affect target gene transcription [3, 57].

Of the five TGFβ-like ligands in C. elegans, dbl-1 (d pp and BMP-like) and daf-7 (dauer formation abnormal) are the best characterized. dbl-1 transmits the Sma/Mab (small/male tail abnormal) pathway signal while daf-7 regulates formation of dauer, an alternative life stage entered in response to low food or high population density [810]. These two pathways share a common type II RSK, daf-4. daf-4 animals are small, exhibit fused male tail sensory rays and constitutively form dauer larvae [11, 12]. Mutants of all other known components of the dauer pathway are either dauer constitutive (daf-c) like daf-7 or dauer defective (daf-d) [3, 13]. Based on the Sma/Mab phenotypes of daf-4 mutants, sma-2, sma-3, sma-4 and sma-6 were identified and cloned. sma-2, sma-3 and sma-4 encode Smads while sma-6 encodes a type I RSK [12, 14]. The Sma/Mab signal is transmitted upon binding of the ligand, DBL-1, to the type II and type I RSKs, DAF-4 and SMA-6 respectively. Once stimulated, SMA-6 activates the Smads, SMA-2, -3 and -4, causing them to affect target gene transcription.

Although the core TGFβ pathway is known, additional components that may further refine signaling remain to be identified. To address this issue, we previously conducted a genetic screen for Sma animals and isolated several new mutants, including kin-29 (also known as sma-11) [15]. We find that kin-29 is able to suppress the long mutant phenotype generated by animals over-expressing the ligand dbl-1. Additionally, we observe that lon-1, a Sma/Mab pathway target gene whose product shows homology to proteins of the cysteine-rich secretory protein (CRISP) family, is up-regulated in kin-29(lf) mutant animals in a similar manner to that seen in a sma-6 null mutant background [16, 17]. kin-29 mutant animals are also developmentally delayed and this defect is partially suppressed by loss of lon-1 function. These data suggest that kin-29 genetically interacts with Sma/Mab pathway signaling downstream of dbl-1 but upstream of lon-1.

Several of the Sma/Mab pathway components have been shown to function in the hypodermis to regulate body size morphogenesis. sma-3, sma-6 and lon-1, when specifically expressed in the hypodermis, have been shown to rescue the body size defects associated with each of these loss-of-function mutations [1518]. The Sma/Mab ligand DBL-1 is primarily expressed in neuronal tissues [8]. It is likely that DBL-1 is secreted from these tissues and targets the hypodermis in order to regulate body size formation. We find that tissue-specific expression of kin-29(+) in the hypodermis rescues the small body size phenotype of kin-29(lf) animals. In addition, we find that kin-29(+), when expressed in the same tissues as dbl-1, also rescues the small body size phenotype of kin-29(lf) animals. Therefore, kin-29 can function in both hypodermal and neuronal tissues with known Sma/Mab pathway components to regulate body size morphogenesis.

In order to understand how kin-29 functions in Sma/Mab pathway signaling, we undertook the molecular characterization of kin-29. It is encoded by F58H12.1, which has an N-terminal kinase domain and a novel C-terminal region. Its kinase domain makes it a distant member of the EMK kinase family, which modulates microtubule organization. kin-29 has a role in olfaction [19], suggesting that the ability to sense environmental signals influences body size regulation.

Results

kin-29encodes a serine threonine kinase

Mutations in members of the Sma/Mab TGFβ-like signaling pathway result in animals that are phenotypically smaller than wild-type. These Sma/Mab mutants are approximately 70% the size of their wild-type counterparts [8, 9, 11, 12, 14]. Based on this small body size phenotype, we set out to isolate additional loci which when mutated resulted in small animals. From an F2 EMS screen of N2 wild-type animals, we identified kin-29(wk61) [15]. kin-29(lf) animals are small, like known Sma/Mab pathway components (Table 1). However, unlike the known pathway components, kin-29 does not possess male tail ray fusions or crumpled spicules, suggesting that kin-29 is involved in regulation of body size morphogenesis but not male tail development.

Table 1 Body size measurements of kin-29 alleles

kin-29 was mapped to linkage group X between unc-2 and fax-1. Appropriate YACs, cosmids, and DNA fragments were used to rescue the gene. The longest cDNA available, y293c7 (Y. Kohara, National Institute of Genetics), spanning this open reading frame was obtained. Based on the ORF sequenced from y293c7, a 10 kb region of genomic DNA containing kin-29 was fused in frame with GFP. This construct, kin-29p::kin-29 gfp, was then injected into kin-29 mutant animals and conferred rescue (Table 3).

Table 3 Rescue of kin-29(wk61) by promoter fusion constructs

We searched for molecular lesions in kin-29(wk61). Genomic DNA spanning the entire coding region of kin-29 was isolated from kin-29(wk61) animals, sequenced and compared to sequence obtained from EST y293c7. Sequence analysis reveals kin-29 to consist of 16 exons that encode a protein of 822 amino acids in length (Fig. 1). A mutation found in the eighth exon of kin-29(wk61) changes a single nucleotide from cytosine to thymine. This change results in a premature termination codon and a truncated protein of 273 amino acids. While this work was in progress, kin-29 was cloned as a modifier of olfactory gene expression [19]. Two alleles from that study, kin-29(oy38) and kin-29(oy39), result from a 526 bp deletion, which is replaced by sequence found on LG X, and a missense mutation in the kinase domain, respectively [19].

Figure 1
figure 1

kin-29 encodes a serine-threonine kinase. Schematic of kin-29 exon/intron structure including 16 exons. The shaded region at the N-terminus consists of the kinase domain with the Q-to-stop mutation of kin-29(wk61) shown. The function of the C-terminus has not yet been determined but it may act as a regulator of kinase activity.

kin-29 encodes a predicted serine-threonine kinase. Within its kinase domain, KIN-29 is homologous to members of the ELKL motif kinase (EMK) family and salt-induced kinase family (~66% identity)(Fig. 2A,2B). Members of the EMK family include C. elegans PAR-1, Drosophila PAR-1, S. pombe KIN-1, and mammalian MARK (microtubule-affinity-regulating kinase) [2023]. EMK family members have been shown to affect cell polarity as well as microtubule stability [20, 22, 23]. The kinase domain of KIN-29 also shows significant homology salt-induced kinases [24, 25]. Salt induced kinases (SIK) were cloned from subtractive libraries derived from genes expressed in the adrenal glands after high salt diets in rat. The biological function of these kinases is not clear. The C-terminal domain of KIN-29 is more divergent and shows little homology with domains in other kinases.

Figure 2
figure 2

Molecular analysis of the kinase domain. (A) Sequence alignment between the kinase domains of KIN-29 (~amino acids 16–267), rat salt-induced kinase (rSalt-Ind Kinase), Drosophila CG4290 (a salt-induced kinase member), and mouse EMK (mEMK). Identical matches in three of the four sequences are indicated by white letters. (B) Dendrogram showing the relationship between the kinase domain of KIN-29 (~amino acids 16–267), and several additional kinases.

KIN-29 encodes a functional kinase

In order to assess whether KIN-29 acts as a functional kinase, 293T cells were transfected with either C-terminal FLAG-tagged full length kin-29 or various constructs, which truncate the carboxy terminal region of the protein. As controls, both the kinase active and kinase inactive mammalian TGFβ type II RSK were also transfected. Lysates were immuniprecipitated with anti-Flag antibody and in vitro kinase assays performed. We observe that full length KIN-29 is capable of autophophorylation (Fig. 3). However, when we truncate the C-terminal domain, we find that the kinase domain, along with the ubiquitin-associated domain (UBA) or the kinase domain (with or without lysine 45 changed to arginine) are no longer capable of autophosphorylation. Lysine 45 is a conserved residue essential for catalytic function in kinases. This indicates that the C-terminal domain is required for autophosphorylation. The C-terminal domain could be required for kinase activity or it may simply be the substrate for autophosphorylation. Lanjuin and colleagues have previously shown that animals possessing a mutation (oy39) in the kinase domain have a small body size [19], indicating that the kinase domain is required for proper body size.

Figure 3
figure 3

KIN-29 is a functional kinase. 293T cells were transfected with C-terminal flag tagged kin-29 constructs (top panel). KIN-29-KU contains amino acids 1–354, which includes the kinase domain and UBA domain. KIN-29K contains amino acids 1–300 which includes only the kinase domain and KIN-29K(K45R) contains amino acids 1–300 with a point mutation at position 45 that changes a lysine to an arginine. FLAG-tagged proteins were immunoprecipitated using anti-Flag antibody and in vitro kinase assays performed. Full length KIN-29 is capable of autophosphorylation similar to mammalian Tβ RII (TGFβ type II RSK) (top panel). Truncating the C-terminal domain of KIN-29 prevents autophosphorylation.

Placement of kin-29in the Sma/Mab pathway

Epistasis between kin-29 and dbl-1 or lon-1 was examined in order to determine the relationship between kin-29 and Sma/Mab pathway signaling. Double mutant analysis between several of the known pathway components and lon-1 results in animals that are long (Lon) [16, 17], making it the most downstream gene in the pathway. We examined lon-1(wk50); kin-29(wk61) double mutants to determine whether kin-29 can be placed in a similar position in the pathway as the current Sma/Mab components. We find that double mutants are longer than the single mutants of kin-29(wk61), suggesting that lon-1 suppresses the Sma phenotype of kin-29 (Table 1).

Next, we examined the relationship between dbl-1 and kin-29. Over-expression of dbl-1 results in Lon animals, suggesting more ligand causes an increase in the TGFβ signal output. When dbl-1 over-expressing animals are crossed into sma-2, sma-3, sma-4, sma-6 or daf-4 mutant backgrounds, the Lon phenotype is suppressed [8] and the animals are Sma. This places the type I receptor and the Smads downstream of the ligand, dbl-1. When dbl-1 is over-expressed in a kin-29(wk61) background, the animals are also Sma (Table 2). Additionally, using a weak allele of sma-6, we generated a sma-6(e1482)unc4(e120); kin-29(wk61) double mutant and examined its body size. We find that these animals are similar in size to that observed for sma-6(e1482)unc4(e120) mutants alone suggesting that sma-6 and kin-29 may not function in parallel pathways (Table 2). This indicates that kin-29 behaves in a manner consistent with known Sma/Mab pathway signaling molecules and is likely to function within this signaling cascade.

Table 2 kin-29 suppresses the dbl-1 over-expression phenotype

Since lon-1 is genetically downstream of the Sma/Mab pathway signaling, we examined whether lon-1 mRNA levels are altered in kin-29 mutants. We have previously shown that lon-1 mRNA levels are up-regulated in sma-6(wk7) mutants and down-regulated in animals that over-express dbl-1 [16, 17]. To test whether lon-1 mRNA is regulated in kin-29 animals, we examined lon-1 mRNA levels in a kin-29(wk61) background (Fig. 4). kin-29(wk61) animals show an increase in the expression level of the lon-1 transcript. This increase is comparable to that previously observed in sma-6(wk7) mutant animals [16].

Figure 4
figure 4

mRNA levels of the Sma/Mab target gene, lon-1 , are negatively regulated in kin-29(wk61) animals. Northern blot showing lon-1 mRNA expression observed in mixed stage populations of N2, sma-6(wk7), sma-3(wk30), and kin-29(wk61) animals. Sma/Mab pathway mutants sma-6(wk7) and sma-3(wk30) show an up-regulation of the lon-1 transcript (lanes 2 and 3). Similarly, kin-29(wk61) also shows an increase in lon-1 mRNA (lane 4). Elongation factor-2 (eft-2) was used to control for amounts of RNA loaded per lane. Levels of mRNA were quantitated using a phosphorimager and IQMacv1.2 software. See Materials and Methods for details on relative transcript level calculations.

kin-29 has been shown to affect the expression of a subset of olfactory receptor genes [19]. Several olfactory receptors expressed in AWB, ASH and ASK sensory neurons were either reduced or up-regulated in the kin-29 mutant background. Given that kin-29 affects mRNA levels of these olfactory receptors, we asked whether kin-29 alters the mRNA expression levels of the Sma/Mab components. We examined sma-6 mRNA expression (the type I receptor) in a kin-29 background and find no changes in expression levels of sma-6 mRNA. Because kin-29 and dbl-1 expression patterns overlap, we examined mRNA expression levels of dbl-1 in a kin-29 mutant background. We find that kin-29 does not affect dbl-1 mRNA expression levels (data not shown).

kin-29expression is diverse and dynamic

In efforts to elucidate the function of kin-29 in TGFβ signaling, we examined its expression pattern. A construct consisting of the kin-29 promoter and coding region fused in frame to gfp was injected into kin-29(wk61) animals. As described above, this construct was able to rescue the small body size phenotype of kin-29(wk61) to wild-type (Table 3). Upon examination of the expression pattern, we observe KIN-29 to be localized to various tissue types (Fig. 5). Most notably, KIN-29 is seen in several neuronal cells in the head and tail throughout the course of development. Several of the sensory neurons found in the head express KIN-29, including ASH, AFD and ASI [19]. Additional neuronal staining is observed in both CAN cells and the ventral nerve cord (Fig. 5A). We find expression both in pharyngeal and body wall muscle (Fig. 5B). During the L1, L3 and L4 stages, we see expression throughout the intestine both in the nuclei and to a lesser extent in the cytoplasm (Fig. 5C) and in cells in the tail (Fig. 5D). This intestinal expression is rarely seen in later stages of development. Occasionally, expression is seen in vulval muscles as well.

Figure 5
figure 5

Expression patterns of kin-29p:: kin-29:gfp rescuing construct in wild-type animals. Animals shown are L4 stage photographed at 63x. kin-29 promoter fusion constructs are expressed throughout development: (A) in the CAN neuron, (B) in body wall muscle, (C) in the intestine, and (D) in cells in the tail.

Hypodermal and neuronal expression of kin-29rescues the small body size phenotype

In order to determine where kin-29 activity is required, we examined the body size of kin-29(lf) animals transformed with constructs expressing kin-29 in specific tissues. elt-3 and rol-6 promoters drive expression in the hypodermis, while dbl-1 drives expression in a subset of neurons. All three promoters were fused to kin-29 genomic DNA sequences. Each of these constructs was injected into kin-29(wk61) animals and transgenic strains were analyzed for body size. Several of the Sma/Mab pathway components, sma-3, sma-6, and lon-1, when specifically expressed in hypodermal tissues, rescue the body size defects associated with loss-of-function mutations in each of these genes [1618, 26]. Using the rol-6 and elt-3 promoters to drive hypodermal expression of the genomic region of kin-29 results in rescue of the small body size phenotype of kin-29(wk61). Since KIN-29 expression overlaps that of the Sma/Mab pathway ligand DBL-1 in the amphid neurons, ventral nerve cord, CAN cells and body wall muscle, we reasoned that KIN-29 and DBL-1 may function together in the same tissues to regulate body size morphogenesis [8, 9]. We find that kin-29 under the control of the dbl-1 promoter rescues the small body size phenotype of kin-29(wk61) animals (Table 3). These data suggest that KIN-29 functions in neuronal and hypodermal tissues to regulate body size morphogenesis (Table 3 and data not shown).

kin-29mutants are small, have delayed growth rates, and reduced brood sizes

The growth properties of Sma/Mab animals differ from other small animals. For example, mutants of the spectrin gene, sma-1, which have been shown to affect embryonic elongation but not thought to be involved in TGFβ signaling, are approximately 50% the size of wild-type animals at hatching [27]. This is in contrast to the body size of L1 animals mutant in known Sma/Mab pathway components. For example, sma-3, sma-6, dbl-1, and lon-1 are indistinguishable in length from wild-type L1 animals at hatching [26]. This suggests that the Sma/Mab pathway components are defective in post-embryonic rather than embryonic stages of development. Sma/Mab pathway mutant animals grow at a slower rate as development progresses through the later larval stages into adulthood [26]. There is no defining switch during development that regulates body growth. We tested whether kin-29 mutations cause body size defects in a similar manner to Sma/Mab pathway mutations or whether kin-29 possessed embryonic defects. We examined the body size of kin-29 mutant animals in comparison to sma-6(wk7) and N2 animals at hatching and then at 24 hour intervals to 96 hours. We find that all three alleles of kin-29 are similar in length at the L1 stage to N2 animals. This is also what we observe for sma-6(wk7) which suggests that kin-29 delays growth post-embryonically, as do Sma/Mab pathway components (Fig. 6). The Sma body size of kin-29 is therefore due to a delay in development in later larval stages.

Figure 6
figure 6

The small body size phenotype of kin-29 animals is a result of defects in postembryonic development. N2, sma-6(wk7), kin-29(wk61), kin-29(oy38) and kin-29(oy39) were hatched and synchronized as L1 animals. L1 animals were measured at time zero and then at 24-hour time points spanning a 96 hour period. kin-29 animals are developmentally delayed and over time, kin-29(lf) animals never reach a wild-type body size. Perimeter measurements for at least 22 animals were averaged at each time point. Error bars represent standard deviation values. Values for N2 and kin-29 mutants are significantly different (p < 0.001).

In addition, we find that kin-29 grows more slowly than N2 and Sma/Mab pathway mutants do. Animals hatched and grown at 20°C were scored based on their developmental stage after 72 hours. We find that 99% of wild-type animals are adults at this time point, while only 2% of kin-29(wk61) animals are adults (Table 4). Lanjuin and colleagues report a similar observation; 98% of wild-type animals hatched and grown at 25°C for 3 days were adults in comparison to approximately 24% of kin-29(oy38) animals [19]. We asked if lon-1(lf) could suppress the developmental delay characteristic of kin-29(wk61) animals (Table 4). lon-1(wk50) mutants on their own show a slight delay in development, but which is distinguishable from the Sma/Mab mutants. In the double mutant lon-1(wk50);kin-29(wk61), we find that the developmental defect of kin-29(wk61) can be partially suppressed by lon-1(wk50). This result is consistent with our conclusion that lon-1 is genetically downstream of kin-29.

Table 4 lon-1 partially suppresses the developmental defect of kin-29(wk61)

We observed that Sma/Mab pathway mutants have a reduced brood size. In addition to the developmental defects, kin-29(wk61) also has a reduced brood size (Table 5). Like sma-6(lf) and lon-1(lf), kin-29(wk61) shows a brood size approximately 30% the size of that seen in wild-type animals. We find that sma-6(wk7) and lon-1(wk50) along with kin-29(oy38) and kin-29(oy39) have a reduction in brood size as well. Although brood size is affected, embryonic survival rate appears to be normal.

Table 5 Brood size analysis of kin-29 alleles

kin-29affects dauer pathway signaling

Several components of the Sma/Mab pathway have been shown to genetically interact with members of the dauer pathway [9, 14]. The dauer-constitutive (Daf-c) phenotype of the type I receptor daf-1 is enhanced by mutations in sma-6. At 15°C, daf-1 mutant strains exhibit a very weak dauer-constitutive phenotype. However, sma-6(wk7); daf-1(m40) mutants show a 50% increase in the number of dauered animals at 15°C [14]. In addition, double mutants between the ligand daf-7(e1372) and either dbl-1(kk3) or sma-2(e502) also have been shown to enhance the weak Daf-c phenotype of daf-7(e1372) at 20°C [9]. These data suggest that there is some crosstalk between the Sma/Mab pathway and the TGFβ-like daf-7 dauer pathway.

Based on these findings, we examined the effects of the kin-29 alleles on dauer formation. Double homozygotes were made between daf-7(e1372) and each of the three alleles of kin-29. Genetic interactions were analyzed at 15°C, 20°C and 25°C. For comparison, daf-7(e1372) mutants raised at 25°C show almost 100% dauered animals compared to no dauered animals at 15°C or 20°C. At 15°C and 20°C, kin-29(oy38) is able to enhance dauer formation of daf-7(e1372) similar to the enhancement observed in sma-6(wk7); daf-7(e1372) mutant animals (Fig. 7A,B). We also see that kin-29(wk61) shows a weak enhancement of dauer formation while the missense mutant kin-29(oy39) shows no genetic interaction at all. These results are consistent with genetic interactions previously observed between Sma/Mab and dauer pathway components. However, at 25°C, we find that kin-29 can also suppress the constitutive dauer formation of daf-7(e1372). kin-29(wk61) and kin-29(oy39) are able to suppress the Daf-c defects of daf-7(e1372) while kin-29(oy38) does not (Fig. 7C).

Figure 7
figure 7

Interaction between kin-29 and the daf-7 TGFβ-like pathway. N2 or dauered animals are not seen at 15°C or 20°C (A, B). daf-7(e1372) mutant animals form constitutive dauers at 25°C (C). kin-29 mutants can both suppress and enhance the dauer constitutive phenotype of daf-7(e1372). At 25°C, daf-7(e1372); kin-29(wk61) and daf-7(e1372); kin-29(oy39) mutants show suppression of the Daf-c phenotype while daf-7(e1372); kin-29(oy38) mutants do not (C). At 15°C and 20°C, daf-7(e1372); kin-29(oy38) mutants show an enhancement in dauer formation similar to that observed in sma-6(wk7); daf-7(e1372) animals(A, B). Additionally, daf-7(e1372); kin-29(wk61) mutants show a mild enhancement of the Daf-c daf-7 phenotype (A, B).

Discussion

KIN-29 functions in hypodermal and neuronal tissues to regulate body size

Expression of the Sma/Mab pathway components in the hypodermis is sufficient to rescue the body size defects seen in mutants. Specific expression of sma-3, sma-6 and lon-1 in the hypodermal tissues has been shown to restore body length in these respective mutant animals [1618, 26]. This implies that body size is regulated largely via hypodermal function. Our work presented here further supports that C. elegans body size is regulated in hypodermal tissues. When the genomic region of kin-29 is specifically expressed in the hypodermis, under the control of the elt-3 and rol-6 promoters, we see that the small body size phenotype of kin-29(wk61) is partially rescued. Although KIN-29 functions in the hypodermis to regulate body size morphogenesis, we do not see KIN-29::GFP, under the control of its own promoter, expressed in the hypodermal tissues, suggesting that KIN-29 expression levels are relatively low in these tissues.

DBL-1 is expressed primarily in neurons, which includes several amphid and pharyngeal neurons, ventral nerve cord, and CAN cells [8, 17]. Since KIN-29 expression closely parallels that seen for DBL-1, we also examined whether the dbl-1 promoter driving kin-29 genomic sequences is capable of rescuing the body size defect of kin-29(wk61). When kin-29 is expressed in the same tissues as dbl-1, we observe partial rescue of the small body size defect seen in kin-29(lf) animals. It has been demonstrated that kin-29 under the control of the unc-14 and odr-4 promoters is able to rescue the body size defect of kin-29 mutant animals [19]. unc-14 is expressed in all neuronal cells while odr-4 is expressed in a subset of the sensory neurons including the AFD neurons where DBL-1 and KIN-29 are also expressed [28, 29]. This suggests that neuronal expression of KIN-29 is also sufficient to regulate body size morphogenesis. Determining how this occurs will require further study.

kin-29is a tissue specific factor that affects the Sma/Mab pathway

Mutations in the ligand dbl-1, the receptors sma-6 and daf-4, and Smads sma-2, sma-3 and sma-4, result in animals that are approximately 70% the size of wild-type animals [8, 9, 11, 12, 14]. Additional defects are seen as male tail ray fusions and crumpled spicules. However, the negatively regulated Sma/Mab target gene lon-1, suppresses the small body size phenotype of sma-2, sma-3, sma-4 and sma-6 but not the male tail defects observed in each of these loss-of-function mutants [16, 17]. This implies that Sma/Mab pathway signaling may branch downstream of the Smads to regulate a subset of genes that control body size morphogenesis while others specifically affect male tail development. We find that kin-29(lf) animals do not posses ray fusions or crumpled spicules and may exert its effects upstream of this branch point in the signaling pathway. In addition, we see that lon-1 is genetically downstream of kin-29 and that kin-29 suppresses the Lon phenotype associated with over expression of dbl-1. Taken together, this data suggests that kin-29 may function in tissues with Sma/Mab pathway components to regulate body size but not male tail formation.

The EMK kinase family and kin-29

Members of the EMK family have been shown to affect cell polarity and microtubule stability. Mammalian MARK phosphorylates microtubule associated proteins and has been shown to destabilize microtubules when over expressed in CHO cells [23]. Drosophila PAR-1 influences the cytoskeletal organization of the oocyte [21]. In wild-type Drosophila oocytes, the microtubules are arranged in an anterior to posterior gradient with no microtubules observed at the most posterior region of the oocyte. Microtubules in Drosophila par-1 mutants, however, are organized around the cortex of the oocyte. In this reorganization, microtubules are now observed in the most posterior region of the oocyte. In addition, posterior localization of Drosophila oskar is dependent on microtubule polarity. oskar is mislocalized in dpar-1 mutants, further supporting the involvement of dpar-1 in regulating microtubule dynamics. C. elegans PAR-1 regulates the early asymmetrical cell divisions of the embryo but has not been shown to have any affects on the microtubule network [20]. KIN-29 only shows homology to the EMK family members within its N-terminal kinase domain, indicating that KIN-29 is a more distantly related member of the EMK family. However, lack of homology between the C-termini of KIN-29 and EMK family proteins suggests that KIN-29 activity may diverge from that observed for members of this family.

How does kin-29function?

We have observed that KIN-29 functions in both neuronal and hypodermal tissues. How kin-29 functions in each of these tissues to regulate body size morphogenesis is unclear. Since kin-29 encodes a kinase it might act to regulate the activities of a variety of molecules that affect Sma/Mab pathway signaling. Recently, it has been shown that several olfactory receptors are misexpressed in kin-29(lf) animals, suggesting that KIN-29 may regulate proper expression levels of various genes [19]. One model is that KIN-29 phosphorylates a transcription factor and/or co-factor, which leads to the transcriptional mis-regulation of some component important for Sma/Mab pathway signaling. We have examined the expression levels of the Sma/Mab ligand dbl-1 and the type I RSK sma-6 and do not see any alteration in their levels of expression. However, this does not rule out that other genes that impinge on pathway signaling might be affected at the transcriptional level in neurons and hypodermal cells. Alternatively, KIN-29 may function in microtubule dynamics as described above [21, 23]. kin-29 might therefore influence microtubule (MT) organization in both neuronal and hypodermal tissues and affect Sma/Mab pathway signaling in each of these cell types.

Dauer interactions show that kin-29(lf)mutants may not sense external cues properly

We have shown that KIN-29 helps to promote dauer formation at 25°C and to suppress dauer formation at 15°C. ttx-3, a LIM homeobox gene, shows a similar genetic interaction with daf-7 [30]. Like kin-29, ttx-3 single mutants do not affect dauer formation. daf-7(e1372); ttx-3(ks5) double mutant animals show an enhanced Daf-c phenotype of daf-7 at 15°C while suppressing it at 25°C. In wild-type animals, high temperatures contribute to dauer formation, while lower temperatures suppress dauer formation. ttx-3 decouples both hot and cold inputs from the dauer pathway, and kin-29 may act similarly [30]. tph-1, a tryptophan hydroxylase involved in the synthesis of serotonin, has been shown to form 10–15 % dauers in the presence of food and this defect is not dependent on temperature which implicates serotonergic signaling in modulating temperature sensitive dauer arrest [31]. tph-1 is also able to enhance the constitutive dauer phenotype of daf-7 mutants at 15°C similar to the enhancement observed for kin-29 [31]. Sze and colleagues did not examine the affects of tph-1 mutants on daf-7 at 25°C. They did show, however, that over-expression of tph-1 in a daf-7 background at 25°C suppresses the Daf-c phenotype of daf-7. This is opposite to what we observe for kin-29. Although there are some similarities between tph-1 and kin-29, tph-1(mg280); kin-29(oy38) double mutants are synthetic-daf at 20°C and 25°C suggesting that kin-29 may not function in a linear pathway with tph-1 but rather parallel to tph-1 [19]. tph-1 has also been shown to regulate the expression of daf-7 while kin-29 does not, suggesting that kin-29 functions downstream or in parallel to daf-7 production to affect TGFβ signaling outputs [19, 31]. kin-29 may partly influence dauer formation through a serotonin mediated pathway and a non-serotonin mediated pathway such as the Sma/Mab pathway. The Sma/Mab pathway has been shown to influence dauer formation in combination with the TGFβ-like daf-7 pathway [9, 14].

Starved animals are smaller than animals grown with abundant food supplies, indicating that environmental conditions influence body size morphogenesis [13]. Drosophila S6 kinase mutants are smaller in body size due to decreased cell size, which is similar to the body size defect observed in nutrient deprived flies [32, 33]. It is thought that S6 kinase alters cell growth in response to nutrients and growth factors by regulating the efficiency of the translational apparatus [34]. Recently, it has been shown that a deletion found within the C. elegans homolog of S6 kinase (sv31) also results in a reduced body size in the adult stage (J. Friberg and S, Tuck, personal communication). S6 kinase (sv31) and kin-29(lf) animals also show other similar phenotypes, including reduced brood size and slow growth defects. In addition, fat accumulation is also observed in S6 kinase (sv31) animals similar to that observed in dauered animals. Previously, it has been demonstrated that animals that show pheromone hypersensitivity are unable to sense food or temperature signals properly [3539]. Recently, kin-29 mutants have been shown to be hypersensitive to pheromone [19]. In addition, kin-29 mutants also possess hyperforaging activity in the presence of abundant food supplies [19]. Hyperforaging is normally observed in animals that have been deprived of food. These defects suggest that kin-29(lf) mutant animals may not sense food or temperature signals properly and this may influence body size regulation. Taken together, this evidence supports an environmental role in regulation of body size. kin-29 may function to transmit these environmental cues to the Sma/Mab TGFβ signaling pathway, thereby affecting proper body size morphogenesis.

Conclusion

In this study, kin-29 was identified in a genetic screen designed to identify modifiers of body size in C. elegans. Mutants in kin-29 result in small animals, and we show that kin-29 affects the dbl-1 signaling pathway in C. elegans. kin-29 also modifies phenotypes from a second TGFβ pathway in C. elegans, the dauer pathway. Further, we show that KIN-29 does contain kinase activity, and that it is capable of phosphorylating itself. KIN-29 functions in neurons and in the hypodermis to control aspects of body size.

Methods

Strains

C. elegans strains were grown using standard methods [40]. kin-29(wk61) was used for body size rescue experiments. N2, sma-6(wk7), kin-29(wk61), kin-29(oy38) and kin-29(oy39) were used in generating growth curves [19]. Interactions between kin-29 and the dauer pathway were examined using daf-7(e1372). Total RNA used for northern blot analysis was isolated from N2, sma-6(wk7), sma-3(wk30), and kin-29(wk61) animals. Epistasis was determined using kin-29(wk61), lon-1(wk50), dbl-1 over expressing strain ctIs40 [pTG96 (sur-5::gfp)], and lon-1(wk50); kin-29(wk61) mutant animals.

Isolation of kin-29(wk61)

kin-29(wk61) was generated from an EMS F2 screen designed to isolate small body size mutants [15]. kin-29(oy38) and kin-29(oy39) were obtained from P. Sengupta [19].

Cloning of kin-29

kin-29(wk61) was mapped to a small region on the X chromosome between unc-2 and fax-1 using genetic markers and deficiencies. The YAC clone Y76F7 from this interval was purified from total yeast DNA using pulse field gel electrophoresis. Injection of YAC Y76F7 into kin-29(wk61) rescued the small body size phenotype. Next DNA from cosmids contained within the region of Y76F7 was isolated and transgenic lines were generated. Cosmid F58H12, with one predicted open reading frame (ORF), conferred rescue. ESTs spanning this region were obtained from the C. elegans cDNA project (Y. Kohara, National Institute of Genetics). The longest EST, y293c7, was sequenced and shows minor differences from the Genefinder prediction. A 10 kb genomic region fused in frame to GFP, which contained the corresponding sequence from y293c7, was generated by PCR as described below. This kin-29p::kin-29:gfp fusion construct rescued the small body size of kin-29(wk61). Genomic DNA from homozygous kin-29(wk61) animals was sequenced. Two independent PCR amplifications were generated for each of the three regions spanning the kin-29 coding region using the following primer sets: CGCTGCGGCCGCTTCAGGCGCCGCCACACCAA/ CGCCGCTGCAGCCGCCGGCAACGAGAATGTA; CGCTGCGGCCGCCCAAGCCAACGTTGCAGGTA/ CGCCGCTGCAGGATAACATGCTCCACTGGCTA; CGCTGCGGCCGCCACCGCACGGGCTAGATATT/ CGCCGCTGCAGCCATTCACTCCGAGCTCCAG. Each PCR product was digested with Not I and Pst I, subcloned into pBluescript SK+, and sequenced.

GFP fusion and tissue-specific expression constructs

kin-29p::kin-29 gfp contains the 10 kb genomic region of kin-29 fused in frame to gfp. This construct was generated using the primers CGCGCTGCAGCAGACCATGGACGT GTTTTAATG and CCGGGGATCCTCCGAGCTCCAGCTTGGATCA, digesting with Pst I and BamH I, and inserting the PCR product into the promoterless vector pPD95.75. kin-29p::gfp was generated by cloning 1.4 kb upstream of the predicted kin-29 ATG into the Hind III and Xba I sites of the GFP insertion vector pPD95.69 (A. Fire, Stanford University). The 1.4 kb piece was generated by PCR using primers CCGGAAGCTTCAGACCATGGACGTGTTTTAATG and CGCGTCTAGATGCAGTGTTGGTGTGGCGGC. Fluorescent GFP expression patterns were examined in larval and adult animals using a Zeiss compound microscope.

kin-29 genomic DNA was ectopically expressed in specific tissues using the promoters rol-6, elt-3 and dbl-1 [8, 41, 42]. The rol-6 and elt-3 promoters express in the hypodermis, while the dbl-1 promoter expresses primarily in neuronal tissues. PCR fragments containing the elt-3, rol-6 and dbl-1 promoters were generated using the primer sets CCGGAAGCTTGTGACACGTTGTTTCACGGTCAT/ CCGGCTGCAGGAAGTTTGAAATACCAGGTAGCCGA, CCGGCTGCAGCTTCGTATTAGATCTCAGCAGC/ CGCGCGTCGACAGTTAGATCTAAAGATATATCCAG, and CCGGCTGCAGCCCGGAAATCACGACCAAATGGGTC/ CGCGCGTCGACAGTTGAGTTGGGCGCATCAGGCAG respectively. elt-3 PCR products were digested with Hind III and Pst I while rol-6 and dbl-1 products were digested with Pst I and Sal I. 7.7 kb PCR fragments comprising kin-29 genomic DNA were generated using the primer sets CCCGGGTCGACATGGCTGCGCCACGGCGGCGTAT/CCGGGGATCCTC CGAGCTCCAGCTTGGATCA and CGCGCTGCAGCAGACCATGGACGTGTT TTAATG/ CCGGGGATCCTCCGAGCTCCAGCTTGGATCA and digested with either Sal I and Bam HI or Pst I and Bam HI respectively. Fragments were inserted in frame into the promoterless gfp insertion vector pPD95.75. All constructs were injected into kin-29(wk61) and transformants were analyzed for body size rescue.

Analysis of body size, brood size and growth rates

For body size measurements, animals were photographed 48 hours after the L4 stage using a Nikon SMZ-U dissecting microscope set at 3.5× magnification and software from Strata Video Shop (Strata Inc.). Screen dimensions were 680 X 460 pixels. Perimeter analysis was done using Image Pro Plus (Mediacybernetics).

For brood size analyses, single L4 animals were picked to individual plates. Every 12 hours, animals were transferred to new plates to continue egg laying. All eggs were counted. 24 hours later, hatchlings were scored.

For growth rate analyses, animals were synchronized. Gravid animals were treated with a hypochlorite/NaOH solution in order to isolate eggs. The eggs were allowed to hatch in M9 for at least 24 hours. Approximately 30 L1 animals were placed onto plates seeded with OP50. Animals were initially measured at the L1 stage (time zero) and then at 24 hour intervals thereafter. The final time point was taken 96 hours after the L1 stage. Images were obtained and perimeter analyses were performed as described above.

Genetic interactions with daf-7(e1372)

Double mutants were generated between daf-7(e1372) and the following mutants: sma-6(wk7), kin-29(wk61), kin-29(oy38), and kin-29(oy39). Gravid animals were placed onto plates well seeded with OP50 and allowed to lay eggs at room temperature. Animals were removed from plates after approximately 30 – 50 eggs were laid. Eggs were allowed to hatch at 15°C, 20°C and 25°C. The number of dauered animals was counted and graphed.

Northern blot analysis

Total RNA from L4 animals was isolated from N2, sma-6(wk7), sma-3(wk30) and kin-29(wk61) as described previously (previously described in [16]. Equal amounts (20–30 μg) of total RNA were loaded per lane onto a 1.2% agarose/6.6% formaldehyde gel and resolved by electrophoresis. Samples were transferred to nitrocellulose (Osmonics Inc.) and baked at 80°C for 2 hours. The lon-1 and dbl-1 probes were generated by digesting both the lon-1 cDNA B1.11 and the dbl-1 cDNA with Eco RI. The sma-6 probe was generated by PCR using the primer set: GCCGCCTCGAGATGAACATCACCTTTATATTTATTCTC/ GCCGCGGATCCTTAAGATTGATTGGTGGCTGAC. Elongation factor-2 and α-tubulin were used as controls to indicate the amount of total RNA loaded per lane. Before probes were added, the nitrocellulose blots were prehybridized with 1 mM EDTA, 0.5 M NaPO4, pH7.2, 7% SDS, and 1% BSA fraction V (Sigma) for at least 30 minutes. Probes were labeled using the Prime It II kit (Stratagene), added to the prehybridization solution, and incubated overnight at 65°C. Blots were washed (1 mM Na2EDTA, 40 mM NaPO4, pH 7.2, and 1% SDS) at least three times at 65°C for 15 minutes. Each blot was placed onto a phosphorimager screen for at least 48 hours and analyzed using a Molecular Dynamics Phosphorimager (Amersham Pharmacia Biotech) and IQMacv1.2 software. For each band, intensity levels were corrected for background and normalized according to the loading control (eft-2 mRNA). Relative transcript levels of the mutants were normalized to the intensity ratio of lon-1/eft-2 of N2.

Kinase assays

C-terminally tagged Flag kin-29 constructs were generated in the mammalian vector pRK5. KIN-29-KU contains amino acids 1–354 which includes the kinase domain and UBA domain. KIN-29K contains amino acids 1–300 which includes only the kinase domain and KIN-29K(K45R) contains amino acids 1–300 with a point mutation at position 45 that changes a lysine to an arginine. Cell transfection, immunoprecipitation and kinase assays were carried out as previously described [41]. Human 293T cells at 30% confluency were transfected with each construct (2 μg in 100 mm plates) using LipofectAMINE (Life Technologies, Inc.). Forty eight h after transfection, cells were lysed in the lysis buffer (25 mM Tris-HCl, 300 mM NaCl, and 1% Triton X-100). Lysates were immunoprecipitated using anti-Flag antibody M2 (Sigma), washed 3 times in the same buffer and a final wash in the kinase buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl2, and 5 mM CaCl2). For in vitro kinase assays, the immunoprecipitated protein samples were divided into two aliquots. One aliquot was analyzed by anti-Flag western blotting. The second aliquot was subjected to a kinase autophosphorylation assay at room temperature for 30 min in the kinase buffer containing 5 μCi of 32P-ATP (5000 μCi/mmol). The reaction was terminated by adding an equal volume of 2 × SDS sample buffer (80 mM Tris, pH 6.8, 3.2% SDS, 16% glycerol, 200 mM dithiothreitol, 0.02% bromphenol blue), then subjected to SDS-PAGE and visualized by autoradiography.

References

  1. Massagué J, Blain SW, Lo RS: TGFβ signaling in growth control, cancer, and heritable disorders. Cell. 2000, 103 (2): 295-309. 10.1016/S0092-8674(00)00121-5.

    Article  PubMed  Google Scholar 

  2. Suga H, Ono K, Miyata T: Multiple TGF-β receptor related genes in sponge and ancient gene duplications before the parazoan-eumetazoan split. FEBS Lett. 1999, 453 (3): 346-350. 10.1016/S0014-5793(99)00749-8.

    Article  CAS  PubMed  Google Scholar 

  3. Patterson GI, Padgett RW: TGF β-related pathways. Roles in Caenorhabditis elegans development. Trends Genet. 2000, 16 (1): 27-33. 10.1016/S0168-9525(99)01916-2.

    Article  CAS  PubMed  Google Scholar 

  4. Finnerty JR, Pang K, Burton P, Paulson D, Martindale MQ: Origins of bilateral symmetry: Hox and Dpp expression in a sea anemone. Science. 2004, 304 (5675): 1335-1337. 10.1126/science.1091946.

    Article  CAS  PubMed  Google Scholar 

  5. Whitman M: Smads and early developmental signaling by the TGFβ superfamily. Genes Dev. 1998, 12 (16): 2445-2462.

    Article  CAS  PubMed  Google Scholar 

  6. Massagué J: TGFβ Signal Transduction. Annu Rev Biochem. 1998, 67: 753-791. 10.1146/annurev.biochem.67.1.753.

    Article  PubMed  Google Scholar 

  7. Heldin CH, Miyazono K, ten Dijke P: TGF-β signalling from cell membrane to nucleus through SMAD proteins. Nature. 1997, 390 (6659): 465-471. 10.1038/37284.

    Article  CAS  PubMed  Google Scholar 

  8. Suzuki Y, Yandell MD, Roy PJ, Krishna S, Savage-Dunn C, Ross RM, Padgett RW, Wood WB: A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans. Development. 1999, 126 (2): 241-250.

    CAS  PubMed  Google Scholar 

  9. Morita K, Chow KL, Ueno N: Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of the TGF-β family. Development. 1999, 126 (6): 1337-1347.

    CAS  PubMed  Google Scholar 

  10. Ren P, Lim CS, Johnsen R, Albert PS, Pilgrim D, Riddle DL: Control of C. elegans larval development by neuronal expression of a TGF-β homolog. Science. 1996, 274 (5291): 1389-1391. 10.1126/science.274.5291.1389.

    Article  CAS  PubMed  Google Scholar 

  11. Estevez M, Attisano L, Wrana JL, Albert PS, Massagué J, Riddle DL: The daf-4 gene encodes a bone morphogenetic protein receptor controlling C. elegans dauer larva development. Nature. 1993, 365 (6447): 644-649. 10.1038/365644a0.

    Article  CAS  PubMed  Google Scholar 

  12. Savage C, Das P, Finelli AL, Townsend SR, Sun CY, Baird SE, Padgett RW: Caenorhabditis elegans genes sma-2, sma-3, and sma-4 define a conserved family of transforming growth factor β pathway components. Proc Natl Acad Sci U S A. 1996, 93 (2): 790-794. 10.1073/pnas.93.2.790.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  13. Riddle DL, Albert PS: Genetic and environmental regulation of dauer larva development. C elegans II. Edited by: Riddle DL, Blumenthal T, Meyer BJ, Priess JR. 1997, Cold Spring Harbor Press, 739-768.

    Google Scholar 

  14. Krishna S, Maduzia LL, Padgett RW: Specificity of TGFβ signaling is conferred by distinct type I receptors and their associated SMAD proteins in Caenorhabditis elegans. Development. 1999, 126 (2): 251-260.

    CAS  PubMed  Google Scholar 

  15. Savage-Dunn C, Maduzia LL, Zimmerman CM, Roberts AF, Cohen S, Tokarz R, Padgett RW: Genetic screen for small body size mutants in C. elegans reveals many TGFβ pathway components. Genesis. 2003, 35 (4): 239-247. 10.1002/gene.10184.

    Article  CAS  PubMed  Google Scholar 

  16. Maduzia LL, Gumienny TL, Zimmerman CM, Wang H, Shetgiri P, Krishna S, Roberts AF, Padgett RW: lon-1 regulates Caenorhabditis elegans body size downstream of the dbl-1 TGFβ signaling pathway. Dev Biol. 2002, 246: 418-428. 10.1006/dbio.2002.0662.

    Article  CAS  PubMed  Google Scholar 

  17. Morita K, Flemming AJ, Sugihara Y, Mochii M, Suzuki Y, Yoshida S, Wood WB, Kohara Y, Leroi AM, Ueno N: A Caenorhabditis elegans TGF-β, DBL-1 controls the expression of LON-1, a PR-related protein, that regulates polyploidization and body length. EMBO J. 2002, 21: 1063-1073. 10.1093/emboj/21.5.1063.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  18. Yoshida S, Morita K, Mochii M, Ueno N: Hypodermal expression of Caenorhabditis elegans TGF-β type I receptor SMA-6 is essential for the growth and maintenance of body length. Dev Biol. 2001, 240 (1): 32-45. 10.1006/dbio.2001.0443.

    Article  CAS  PubMed  Google Scholar 

  19. Lanjuin A, Sengupta P: Regulation of chemosensory receptor expression and sensory signaling by the KIN-29 Ser/Thr kinase. Neuron. 2002, 33: 369-381. 10.1016/S0896-6273(02)00572-X.

    Article  CAS  PubMed  Google Scholar 

  20. Guo S, Kemphues KJ: par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell. 1995, 81 (4): 611-620. 10.1016/0092-8674(95)90082-9.

    Article  CAS  PubMed  Google Scholar 

  21. Shulman JM, Benton R, St Johnston D: The Drosophila homolog of C. elegans PAR-1 organizes the oocyte cytoskeleton and directs oskar mRNA localization to the posterior pole. Cell. 2000, 101 (4): 377-388. 10.1016/S0092-8674(00)80848-X.

    Article  CAS  PubMed  Google Scholar 

  22. Levin DE, Bishop JM: A putative protein kinase gene (kin1+) is important for growth polarity in Schizosaccharomyces pombe. Proc Natl Acad Sci U S A. 1990, 87 (21): 8272-8276.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  23. Drewes G, Ebneth A, Preuss U, Mandelkow EM, Mandelkow E: MARK, a novel family of protein kinases that phosphorylate microtubule- associated proteins and trigger microtubule disruption. Cell. 1997, 89 (2): 297-308. 10.1016/S0092-8674(00)80208-1.

    Article  CAS  PubMed  Google Scholar 

  24. Horike N, Takemori H, Katoh Y, Doi J, Min L, Asano T, Sun XJ, Yamamoto H, Kasayama S, Muraoka M, Nonaka Y, Okamoto M: Adipose-specific expression, phosphorylation of Ser794 in insulin receptor substrate-1, and activation in diabetic animals of salt-inducible kinase-2. J Biol Chem. 2003, 278 (20): 18440-18447. 10.1074/jbc.M211770200.

    Article  CAS  PubMed  Google Scholar 

  25. Wang Z, Takemori H, Halder SK, Nonaka Y, Okamoto M: Cloning of a novel kinase (SIK) of the SNF1/AMPK family from high salt diet-treated rat adrenal. FEBS Lett. 1999, 453 (1-2): 135-139. 10.1016/S0014-5793(99)00708-5.

    Article  CAS  PubMed  Google Scholar 

  26. Savage-Dunn C, Tokarz R, Wang H, Cohen S, Giannikas C, Padgett RW: SMA-3 smad has specific and critical functions in DBL-1/SMA-6 TGFβ- related signaling. Dev Biol. 2000, 223 (1): 70-76. 10.1006/dbio.2000.9713.

    Article  CAS  PubMed  Google Scholar 

  27. McKeown C, Praitis V, Austin J: sma-1 encodes a bH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development. 1998, 125 (11): 2087-2098.

    CAS  PubMed  Google Scholar 

  28. Dwyer ND, Troemel ER, Sengupta P, Bargmann CI: Odorant receptor localization to olfactory cilia is mediated by ODR-4, a novel membrane-associated protein. Cell. 1998, 93 (3): 455-466. 10.1016/S0092-8674(00)81173-3.

    Article  CAS  PubMed  Google Scholar 

  29. Ogura K, Shirakawa M, Barnes TM, Hekimi S, Ohshima Y: The UNC-14 protein required for axonal elongation and guidance in Caenorhabditis elegans interacts with the serine/threonine kinase UNC- 51. Genes Dev. 1997, 11 (14): 1801-1811.

    Article  CAS  PubMed  Google Scholar 

  30. Hobert O, Mori I, Yamashita Y, Honda H, Ohshima Y, Liu Y, Ruvkun G: Regulation of interneuron function in the C. elegans thermoregulatory pathway by the ttx-3 LIM homeobox gene. Neuron. 1997, 19 (2): 345-357. 10.1016/S0896-6273(00)80944-7.

    Article  CAS  PubMed  Google Scholar 

  31. Sze JY, Victor M, Loer C, Shi Y, Ruvkun G: Food and metabolic signalling defects in a Caenorhabditis elegans serotonin-synthesis mutant. Nature. 2000, 403 (6769): 560-564. 10.1038/35000609.

    Article  CAS  PubMed  Google Scholar 

  32. Montagne J, Stewart MJ, Stocker H, Hafen E, Kozma SC, Thomas G: Drosophila S6 kinase: a regulator of cell size. Science. 1999, 285 (5436): 2126-2129. 10.1126/science.285.5436.2126.

    Article  CAS  PubMed  Google Scholar 

  33. Robertson FW: The ecological genetics of growth in Drosophila IV. The genetic correlation between the duration of the larval period and body size in relation to the larval diet. Genetical Research. 1963, 4: 74-92.

    Article  Google Scholar 

  34. Potter CJ, Xu T: Mechanisms of size control. Curr Opin Genet Dev. 2001, 11 (3): 279-286. 10.1016/S0959-437X(00)00191-X.

    Article  CAS  PubMed  Google Scholar 

  35. Ailion M, Thomas JH: Dauer formation induced by high temperatures in Caenorhabditis elegans. Genetics. 2000, 156 (3): 1047-1067.

    PubMed Central  CAS  PubMed  Google Scholar 

  36. Daniels SA, Ailion M, Thomas JH, Sengupta P: egl-4 acts through a transforming growth factor-β/SMAD pathway in Caenorhabditis elegans to regulate multiple neuronal circuits in response to sensory cues. Genetics. 2000, 156 (1): 123-141.

    PubMed Central  CAS  PubMed  Google Scholar 

  37. Golden JW, Riddle DL: A pheromone-induced developmental switch in Caenorhabditis elegans: temperature-sensitive mutants reveal a wild-type temperature-dependent process. Proc Natl Acad Sci USA. 1984, 81: 819-823.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  38. Golden JW, Riddle DL: The Caenorhabditis elegans dauer larva: developmental effects of pheromone, food, and temperature. Dev Biol. 1984, 102 (2): 368-378. 10.1016/0012-1606(84)90201-X.

    Article  CAS  PubMed  Google Scholar 

  39. Thomas JH, Birnby DA, Vowels JJ: Evidence for parallel processing of sensory information controlling dauer formation in Caenorhabditis elegans. Genetics. 1993, 134 (4): 1105-1117.

    PubMed Central  CAS  PubMed  Google Scholar 

  40. Brenner S: The genetics of Caenorhabditis elegans. Genetics. 1974, 77 (1): 71-94.

    PubMed Central  CAS  PubMed  Google Scholar 

  41. Gilleard JS, Shafi Y, Barry JD, McGhee JD: ELT-3: A Caenorhabditis elegans GATA factor expressed in the embryonic epidermis during morphogenesis. Dev Biol. 1999, 208 (2): 265-280. 10.1006/dbio.1999.9202.

    Article  CAS  PubMed  Google Scholar 

  42. Mello CC, Kramer JM, Stinchcomb DT, Ambros V: Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 1991, 10: 3959-3970.

    PubMed Central  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank A. Lanjiun and P. Sengupta for exchanging information and strains prior to publication and for useful discussions, and Y. Kohara for cDNA clones. We are grateful to T. Gumienny and C. Savage-Dunn and for useful comments on the manuscript, and lab members for useful scientific discussions. We also thank J. Friberg and S. Tuck for communicating unpublished work regarding S6 kinase. This work was supported by a grant from the NIH to R.W.P. L.L.M. was supported by the American Association of University Women Dissertation Fellowship and by the New Jersey Commission on Cancer Research. C.M.Z. was supported by the New Jersey Commission on Cancer Research and A.F.R. was supported by a Charles and Joanna Busch Predoctoral Fellowship and Biotechnology Training Grant from the NIH. Some mutant nematode strains were obtained from the Caenorhabditis Genetics Center, which is supported by the NIH National Center for Research Resources (NCRR).

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Richard W Padgett.

Additional information

Authors' contributions

L.L.M. performed the majority of experiments, including the mapping and molecular cloning of kin-29. S.C initiated the early phases of mapping kin-29. A.F.R. analyzed brood size. C.M.Z. and A.F.R. assisted with generating transgenic nematode lines. H.W. and L.C. provided assistance in construct design and scoring of genetic experiments. X.L. and X-H.F. performed the kinase assays. R. W. P. implemented and supervised the project and R.W.P. and L.L.M. prepared the manuscript.

Authors’ original submitted files for images

Rights and permissions

Reprints and permissions

About this article

Cite this article

Maduzia, L.L., Roberts, A.F., Wang, H. et al. C. elegans serine-threonine kinase KIN-29 modulates TGFβ signaling and regulates body size formation. BMC Dev Biol 5, 8 (2005). https://0-doi-org.brum.beds.ac.uk/10.1186/1471-213X-5-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/1471-213X-5-8

Keywords