Skip to main content

Table 2 Oligonucleotide primers used for Real-time RT-PCR analysis

From: Gene expression profiles of novel caprine placental prolactin-related proteins similar to bovine placental prolactin-related proteins

Gene Primer Sequence Position
cPRP1 Forward 5' CAAATCTGCTCCTGTGCCAA 3' 132–151
(AB231295) Reverse 5' AAGGAGATGGCGAACAAGTCA 3' 198–178
bPRP1 Forward 5' TCGTGTTGCTGTACTCCTGGAA 3' 458–479
(J02944) Reverse 5' GGAAGGCGTTTGACAGTTCTTT 3' 541–520
cPRP6 Forward 5' GATATTTACACCAAGCTCATGGCA 3' 562–585
(AB231296) Reverse 5' GGATGGCATGGATGTGGATT 3' 631–612
bPRP6 Forward 5' GGAGAATAATATTTACTGGTCGGGAC 3' 447–472
(AB245482) Reverse 5' AAAATGCAGAATGACGCACATCT 3' 520–498
cGAPDH Forward 5' GCCATCACCATCTTCCAGGA 3' 115–134
(AJ431207) Reverse 5' CCACGTACTCAGCACCAGCA 3' 184–165
bGAPDH Forward 5' AAGGCCATCACCATCTTCCA 3' 178–197
(U85042) Reverse 5' CCACTACATACTCAGCACCAGCAT 3' 253–230