Skip to main content

Table 1 Oligonucleotide primers used for RT-PCR analysis

From: Gene expression profiles of novel caprine placental prolactin-related proteins similar to bovine placental prolactin-related proteins

Gene Primer Sequence Position
cPRP1 Forward 5' TGTCCCACGAGTTCCATAACGT 3' 237–258
(AB231295) Reverse 5' GCACGCCAGGATCTTGATGTA 3' 742–722
cPRP6 Forward 5' TCACCTCAGAATCCCTTTCAGA 3' 38–59
(AB231296) Reverse 5' CATGCCATGAGCTTGGTGTAA 3' 587–567
cGAPDH Forward 5' GACCCCTTCATTGACCTTCAC 3' 1–21
(AJ431207) Reverse 5' TCATAAGTCCCTCCACGATGC 3' 424–404
bPRP1 Forward 5' CTAATCTGCTCCTGTGCCAAGG 3' 173–194
(J02944) Reverse 5' ATGACGCCTATCTTCAGCGCT 3' 705–685
bPRP6 Forward 5' TGTCCTGACGTGTCTGACATCC 3' 19–40
(AB245482) Reverse 5' GCAGGCAGTGGAACAGGCTATA 3' 541–520
bGAPDH Forward 5' CCTTCATTGACCTTCACTACATGGTCTA 3' 71–98
(U85042) Reverse 5' GCTGTAGCCAAATTCATTGTCGTACCA 3' 927–901