Skip to main content

Table 1 Primer sequences and amplicon sizes for real-time PCR

From: Expression of canonical WNT/β-CATENIN signaling components in the developing human lung

Gene Accession   Sequences (5’ → 3’) Length Amplicon
WNT2 NM_003391 For CTGACCTGATGCAGACGCAAG 21 bp 139 bp
   Rev AGGAGCCACCTGTAGCTCTCATGTA 25 bp  
WNT7B NM_058238 For GTCAGGGATGTTTGTCCCACTTG 23 bp 69 bp
   Rev TCTGGTAGGTCCTTGTGCCACTC 23 bp  
FZD4 NM_012193 For TACCTCACAAAACCCCCATCC 21 bp 132 bp
   Rev GGCTGTATAAGCCAGCATCAT 21 bp  
FZD7 NM_003507 For GCAAAGCAGCGCAAATCTGA 20 bp 116 bp
   Rev AACCTCTGGCTTAACGGTGTGTG 23 bp  
LRP5 NM_002335 For ATGGGCGCCAGAACATCAA 19 bp 117 bp
   Rev AGATGTCGATGCTGAGGTCGTG 22 bp  
LRP6 NM_002336 For TTGTTGCTTTATGCAAACAGACG 23 bp 167 bp
   Rev CGTTTAATGGCTTCTTCGCTGAC 23 bp  
DVL2 NM_004422 For TGAGCAACGATGACGCTGTG 20 bp 148 bp
   Rev GCAGGGTCAATTGGCTGGA 19 bp  
DVL3 NM_004423 For ACAATGCCAAGCTACCATGCTTC 23 bp 109 bp
   Rev AGCTCCGATGGGTTATCAGCAC 22 bp  
GSK-3β NM_002093 For TCGAGAGCTCCAGATCATGAGAA 23 bp 124 bp
   Rev CGGAACATAGTCCAGCACCAGA 22 bp  
CTNNB1 NM_001904 For TCTGAGGACAAGCCACAAGATTACA 25 bp 122 bp
(β-CATENIN)   Rev TGGGCACCAATATCAAGTCCAA 22 bp  
APC NM_001127511 For CATGATGCTGAGCGGCAGA 19 bp 104 bp
   Rev GCTGTTTCATGGTCCATTCGTG 22 bp  
AXIN2 NM_004655 For GAGTGGACTTGTGCCGACTTCA 22 bp 189 bp
   Rev GGTGGCTGGTGCAAAGACATAG 22 bp  
TCF4 NM_001083962 For CTGCCTTAGGGACGGACAAAG 21 bp 101 bp
   Rev TGCCAAAGAAGTTGGTCCATTTT 23 bp  
LEF1 NM_016269 For AATGAGAGCGAATGTCGTTGC 21 bp 137 bp
   Rev GCTGTCTTTCTTTCCGTGCTA 21 bp  
SOSTDC1 NM_015464 For CTTGCCCCTGCCAGTGCTCC 20 bp 211 bp
   Rev CTCGTTGTGCTGCCGGGTGT 20 bp  
β-ACTIN NM_001101 For CATGTACGTTGCTATCCAGGC 21 bp 250 bp
   Rev CTCCTTAATGTCACGCACGAT 21 bp